| p-value: | 1e-194 |
| log p-value: | -4.486e+02 |
| Information Content per bp: | 1.578 |
| Number of Target Sequences with motif | 5006.0 |
| Percentage of Target Sequences with motif | 34.11% |
| Number of Background Sequences with motif | 7973.8 |
| Percentage of Background Sequences with motif | 23.24% |
| Average Position of motif in Targets | 157.1 +/- 145.8bp |
| Average Position of motif in Background | 103.7 +/- 67.6bp |
| Strand Bias (log2 ratio + to - strand density) | 10.0 |
| Multiplicity (# of sites on avg that occur together) | 1.41 |
| Motif File: | file (matrix) reverse opposite |
| SVG Files for Logos: | forward logo reverse opposite |
hsa-miR-378e MIMAT0018927 Homo sapiens miR-378e Targets (miRBase)
| Match Rank: | 1 |
| Score: | 0.75 |
| Offset: | -10 |
| Orientation: | forward strand |
| Alignment: | ----------AAGTCCAY- TCCTGACTCCAAGTCCAGT |
|
|
|
hsa-miR-378b MIMAT0014999 Homo sapiens miR-378b Targets (miRBase)
| Match Rank: | 2 |
| Score: | 0.75 |
| Offset: | -10 |
| Orientation: | forward strand |
| Alignment: | ----------AAGTCCAY- TTCTGCCTCCAAGTCCAGT |
|
|
|
hsa-miR-378f MIMAT0018932 Homo sapiens miR-378f Targets (miRBase)
| Match Rank: | 3 |
| Score: | 0.74 |
| Offset: | -11 |
| Orientation: | forward strand |
| Alignment: | -----------AAGTCCAY- CTTCTGGCTCCAAGTCCAGT |
|
|
|
hsa-miR-378d MIMAT0018926 Homo sapiens miR-378d Targets (miRBase)
| Match Rank: | 4 |
| Score: | 0.74 |
| Offset: | -11 |
| Orientation: | forward strand |
| Alignment: | -----------AAGTCCAY- TTTCTGACTCCAAGTCCAGT |
|
|
|
hsa-miR-378h MIMAT0018984 Homo sapiens miR-378h Targets (miRBase)
| Match Rank: | 5 |
| Score: | 0.73 |
| Offset: | -12 |
| Orientation: | forward strand |
| Alignment: | ------------AAGTCCAY- CCATCTGACACCAAGTCCAGT |
|
|
|
hsa-miR-378 MIMAT0000732 Homo sapiens miR-378 Targets (miRBase)
| Match Rank: | 6 |
| Score: | 0.73 |
| Offset: | -12 |
| Orientation: | forward strand |
| Alignment: | ------------AAGTCCAY- CCTTCTGACTCCAAGTCCAGT |
|
|
|
hsa-miR-422a MIMAT0001339 Homo sapiens miR-422a Targets (miRBase)
| Match Rank: | 7 |
| Score: | 0.73 |
| Offset: | -13 |
| Orientation: | forward strand |
| Alignment: | -------------AAGTCCAY- GCCTTCTGACCCTAAGTCCAGT |
|
|
|
hsa-miR-1269 MIMAT0005923 Homo sapiens miR-1269 Targets (miRBase)
| Match Rank: | 8 |
| Score: | 0.71 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------AAGTCCAY CCAGTAGCACGGCTCAGTCCAG |
|
|
|
hsa-miR-1269b MIMAT0019059 Homo sapiens miR-1269b Targets (miRBase)
| Match Rank: | 9 |
| Score: | 0.71 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------AAGTCCAY CCAGTAGCATGGCTCAGTCCAG |
|
|
|
hsa-miR-378c MIMAT0016847 Homo sapiens miR-378c Targets (miRBase)
| Match Rank: | 10 |
| Score: | 0.71 |
| Offset: | -16 |
| Orientation: | forward strand |
| Alignment: | ----------------AAGTCCAY- CCACTCTTCTGACTCCAAGTCCAGT |
|
|
|