| p-value: | 1e-47 |
| log p-value: | -1.091e+02 |
| Information Content per bp: | 1.654 |
| Number of Target Sequences with motif | 932.0 |
| Percentage of Target Sequences with motif | 6.35% |
| Number of Background Sequences with motif | 1316.3 |
| Percentage of Background Sequences with motif | 3.84% |
| Average Position of motif in Targets | 147.4 +/- 140.9bp |
| Average Position of motif in Background | 103.4 +/- 68.3bp |
| Strand Bias (log2 ratio + to - strand density) | 10.0 |
| Multiplicity (# of sites on avg that occur together) | 1.05 |
| Motif File: | file (matrix) reverse opposite |
| SVG Files for Logos: | forward logo reverse opposite |
hsa-miR-124* MIMAT0004591 Homo sapiens miR-124* Targets (miRBase)
| Match Rank: | 1 |
| Score: | 0.65 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------TGGACACGTT ATCAAGGTCCGCTGTGAACACG-- |
|
|
|
hsa-miR-3657 MIMAT0018077 Homo sapiens miR-3657 Targets (miRBase)
| Match Rank: | 2 |
| Score: | 0.63 |
| Offset: | -13 |
| Orientation: | forward strand |
| Alignment: | -------------TGGACACGTT AATCACCAATAATGGGACACA-- |
|
|
|
hsa-miR-4761-5p MIMAT0019908 Homo sapiens miR-4761-5p Targets (miRBase)
| Match Rank: | 3 |
| Score: | 0.63 |
| Offset: | -9 |
| Orientation: | forward strand |
| Alignment: | ---------TGGACACGTT-- GGTCAGGCATGCACACCTTGT |
|
|
|
hsa-miR-4669 MIMAT0019749 Homo sapiens miR-4669 Targets (miRBase)
| Match Rank: | 4 |
| Score: | 0.62 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------TGGACACGTT CCTCCTCCACTTCCCGGACACA-- |
|
|
|
hsa-miR-3177-5p MIMAT0019215 Homo sapiens miR-3177-5p Targets (miRBase)
| Match Rank: | 5 |
| Score: | 0.60 |
| Offset: | -15 |
| Orientation: | forward strand |
| Alignment: | ---------------TGGACACGTT AGCGCCTGGCACGTGTGTACACA-- |
|
|
|
hsa-miR-648 MIMAT0003318 Homo sapiens miR-648 Targets (miRBase)
| Match Rank: | 6 |
| Score: | 0.59 |
| Offset: | -10 |
| Orientation: | forward strand |
| Alignment: | ----------TGGACACGTT ACCAGTGCCCTGCACACTT- |
|
|
|
hsa-miR-33a* MIMAT0004506 Homo sapiens miR-33a* Targets (miRBase)
| Match Rank: | 7 |
| Score: | 0.58 |
| Offset: | -11 |
| Orientation: | forward strand |
| Alignment: | -----------TGGACACGTT- GTGATGCACTGTGGAAACATTG |
|
|
|
hsa-miR-2964a-5p MIMAT0019747 Homo sapiens miR-2964a-5p Targets (miRBase)
| Match Rank: | 8 |
| Score: | 0.58 |
| Offset: | -13 |
| Orientation: | forward strand |
| Alignment: | -------------TGGACACGTT CGAGAATTGTGGCTGGACATCT- |
|
|
|
hsa-miR-1204 MIMAT0005868 Homo sapiens miR-1204 Targets (miRBase)
| Match Rank: | 9 |
| Score: | 0.58 |
| Offset: | -12 |
| Orientation: | forward strand |
| Alignment: | ------------TGGACACGTT ATAATGGAGACCAGGCCACGA- |
|
|
|
hsa-miR-4255 MIMAT0016885 Homo sapiens miR-4255 Targets (miRBase)
| Match Rank: | 10 |
| Score: | 0.55 |
| Offset: | -8 |
| Orientation: | forward strand |
| Alignment: | --------TGGACACGTT TCCATCTCTGAACACTG- |
|
|
|