| p-value: | 1e-45 |
| log p-value: | -1.053e+02 |
| Information Content per bp: | 1.909 |
| Number of Target Sequences with motif | 4410.0 |
| Percentage of Target Sequences with motif | 30.05% |
| Number of Background Sequences with motif | 8526.3 |
| Percentage of Background Sequences with motif | 24.85% |
| Average Position of motif in Targets | 153.5 +/- 153.9bp |
| Average Position of motif in Background | 103.2 +/- 68.9bp |
| Strand Bias (log2 ratio + to - strand density) | 10.0 |
| Multiplicity (# of sites on avg that occur together) | 1.38 |
| Motif File: | file (matrix) reverse opposite |
| SVG Files for Logos: | forward logo reverse opposite |
hsa-miR-93* MIMAT0004509 Homo sapiens miR-93* Targets (miRBase)
| Match Rank: | 1 |
| Score: | 0.78 |
| Offset: | -15 |
| Orientation: | forward strand |
| Alignment: | ---------------CAGCAG- CGGGAAGTGCTAGCTCAGCAGT |
|
|
|
hsa-miR-370 MIMAT0000722 Homo sapiens miR-370 Targets (miRBase)
| Match Rank: | 2 |
| Score: | 0.78 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------CAGCAG-- ACCAGGTTCCACCCCAGCAGGC |
|
|
|
hsa-miR-3692* MIMAT0018121 Homo sapiens miR-3692* Targets (miRBase)
| Match Rank: | 3 |
| Score: | 0.76 |
| Offset: | -17 |
| Orientation: | forward strand |
| Alignment: | -----------------CAGCAG- CAGTATCCACTCCTGACCAGCAGG |
|
|
|
hsa-miR-4456 MIMAT0018978 Homo sapiens miR-4456 Targets (miRBase)
| Match Rank: | 4 |
| Score: | 0.73 |
| Offset: | -10 |
| Orientation: | forward strand |
| Alignment: | ----------CAGCAG- AAAAGGAAGCCACCAGG |
|
|
|
hsa-miR-4299 MIMAT0016851 Homo sapiens miR-4299 Targets (miRBase)
| Match Rank: | 5 |
| Score: | 0.72 |
| Offset: | -11 |
| Orientation: | forward strand |
| Alignment: | -----------CAGCAG- GCCTCTCATGTCACCAGC |
|
|
|
hsa-miR-4502 MIMAT0019038 Homo sapiens miR-4502 Targets (miRBase)
| Match Rank: | 6 |
| Score: | 0.71 |
| Offset: | -15 |
| Orientation: | forward strand |
| Alignment: | ---------------CAGCAG- CTTCAGCACCATCATCATCAGC |
|
|
|
hsa-miR-548q MIMAT0011163 Homo sapiens miR-548q Targets (miRBase)
| Match Rank: | 7 |
| Score: | 0.70 |
| Offset: | -15 |
| Orientation: | forward strand |
| Alignment: | ---------------CAGCAG- CCGCCATTACTTTTGCACCAGC |
|
|
|
hsa-miR-138 MIMAT0000430 Homo sapiens miR-138 Targets (miRBase)
| Match Rank: | 8 |
| Score: | 0.69 |
| Offset: | -15 |
| Orientation: | forward strand |
| Alignment: | ---------------CAGCAG-- CGGCCTGATTCACAACACCAGCT |
|
|
|
hsa-miR-4686 MIMAT0019773 Homo sapiens miR-4686 Targets (miRBase)
| Match Rank: | 9 |
| Score: | 0.68 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------CAGCAG--- AACACCAGAAAGCCCAGCAGATA |
|
|
|
hsa-miR-1267 MIMAT0005921 Homo sapiens miR-1267 Targets (miRBase)
| Match Rank: | 10 |
| Score: | 0.67 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------CAGCAG- TGGGGATTACACTTCAACAGG |
|
|
|