| p-value: | 1e-41 |
| log p-value: | -9.542e+01 |
| Information Content per bp: | 1.937 |
| Number of Target Sequences with motif | 2590.0 |
| Percentage of Target Sequences with motif | 17.65% |
| Number of Background Sequences with motif | 4686.9 |
| Percentage of Background Sequences with motif | 13.66% |
| Average Position of motif in Targets | 157.6 +/- 155.8bp |
| Average Position of motif in Background | 103.1 +/- 66.4bp |
| Strand Bias (log2 ratio + to - strand density) | 10.0 |
| Multiplicity (# of sites on avg that occur together) | 1.16 |
| Motif File: | file (matrix) reverse opposite |
| SVG Files for Logos: | forward logo reverse opposite |
hsa-miR-676* MIMAT0018203 Homo sapiens miR-676* Targets (miRBase)
| Match Rank: | 1 |
| Score: | 0.74 |
| Offset: | -15 |
| Orientation: | forward strand |
| Alignment: | ---------------TGAAGA TGCAAGTCCTGAGGTTGAAGA |
|
|
|
hsa-miR-3977 MIMAT0019362 Homo sapiens miR-3977 Targets (miRBase)
| Match Rank: | 2 |
| Score: | 0.71 |
| Offset: | -15 |
| Orientation: | forward strand |
| Alignment: | ---------------TGAAGA-- TAAGGTTAATTACGATGAAGCAC |
|
|
|
hsa-miR-22* MIMAT0004495 Homo sapiens miR-22* Targets (miRBase)
| Match Rank: | 3 |
| Score: | 0.70 |
| Offset: | -13 |
| Orientation: | forward strand |
| Alignment: | -------------TGAAGA--- TAAAGCTTGCCACTGAAGAACT |
|
|
|
hsa-miR-412 MIMAT0002170 Homo sapiens miR-412 Targets (miRBase)
| Match Rank: | 4 |
| Score: | 0.68 |
| Offset: | -17 |
| Orientation: | forward strand |
| Alignment: | -----------------TGAAGA ACGGCTAGTGGACCAGGTGAAGT |
|
|
|
hsa-miR-205 MIMAT0000266 Homo sapiens miR-205 Targets (miRBase)
| Match Rank: | 5 |
| Score: | 0.65 |
| Offset: | -15 |
| Orientation: | forward strand |
| Alignment: | ---------------TGAAGA- CAGACTCCGGTGGAATGAAGGA |
|
|
|
hsa-miR-877* MIMAT0004950 Homo sapiens miR-877* Targets (miRBase)
| Match Rank: | 6 |
| Score: | 0.63 |
| Offset: | -12 |
| Orientation: | forward strand |
| Alignment: | ------------TGAAGA--- CTGGGAGGAGGGAGAAGAGGA |
|
|
|
hsa-miR-4778-3p MIMAT0019937 Homo sapiens miR-4778-3p Targets (miRBase)
| Match Rank: | 7 |
| Score: | 0.62 |
| Offset: | -13 |
| Orientation: | forward strand |
| Alignment: | -------------TGAAGA--- TCAACTCTGCAAAGGAAGAAGA |
|
|
|
hsa-miR-2682* MIMAT0013518 Homo sapiens miR-2682* Targets (miRBase)
| Match Rank: | 8 |
| Score: | 0.61 |
| Offset: | -12 |
| Orientation: | forward strand |
| Alignment: | ------------TGAAGA---- GGAAGACAGCGCTGAAGAGGCG |
|
|
|
hsa-miR-141* MIMAT0004598 Homo sapiens miR-141* Targets (miRBase)
| Match Rank: | 9 |
| Score: | 0.59 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------TGAAGA-- TCCAACACTGTACTGGAAGATG |
|
|
|
hsa-miR-4659b-3p MIMAT0019734 Homo sapiens miR-4659b-3p Targets (miRBase)
| Match Rank: | 10 |
| Score: | 0.59 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------TGAAGA-- AGCTGCCATGTCTAAGAAGAAA |
|
|
|