| p-value: | 1e-29 |
| log p-value: | -6.798e+01 |
| Information Content per bp: | 1.530 |
| Number of Target Sequences with motif | 505.0 |
| Percentage of Target Sequences with motif | 3.44% |
| Number of Background Sequences with motif | 684.9 |
| Percentage of Background Sequences with motif | 2.00% |
| Average Position of motif in Targets | 163.1 +/- 158.9bp |
| Average Position of motif in Background | 104.8 +/- 60.5bp |
| Strand Bias (log2 ratio + to - strand density) | 10.0 |
| Multiplicity (# of sites on avg that occur together) | 1.02 |
| Motif File: | file (matrix) reverse opposite |
| SVG Files for Logos: | forward logo reverse opposite |
hsa-miR-598 MIMAT0003266 Homo sapiens miR-598 Targets (miRBase)
| Match Rank: | 1 |
| Score: | 0.62 |
| Offset: | -16 |
| Orientation: | forward strand |
| Alignment: | ----------------GACGTACT TGACGATGACAACGATGACGTA-- |
|
|
|
hsa-miR-548k MIMAT0005882 Homo sapiens miR-548k Targets (miRBase)
| Match Rank: | 2 |
| Score: | 0.59 |
| Offset: | -11 |
| Orientation: | forward strand |
| Alignment: | -----------GACGTACT--- AGCAAAATCCGCAAGTACTTTT |
|
|
|
hsa-miR-770-5p MIMAT0003948 Homo sapiens miR-770-5p Targets (miRBase)
| Match Rank: | 3 |
| Score: | 0.59 |
| Offset: | -12 |
| Orientation: | forward strand |
| Alignment: | ------------GACGTACT--- TGGCCCTGACACGTGGTACTGGA |
|
|
|
hsa-miR-1911 MIMAT0007885 Homo sapiens miR-1911 Targets (miRBase)
| Match Rank: | 4 |
| Score: | 0.56 |
| Offset: | -13 |
| Orientation: | forward strand |
| Alignment: | -------------GACGTACT-- CCCAACAGACATGGCGGTACTCA |
|
|
|
hsa-miR-1297 MIMAT0005886 Homo sapiens miR-1297 Targets (miRBase)
| Match Rank: | 5 |
| Score: | 0.55 |
| Offset: | -5 |
| Orientation: | forward strand |
| Alignment: | -----GACGTACT---- CACCTGAATTACTTGAA |
|
|
|
hsa-miR-520f MIMAT0002830 Homo sapiens miR-520f Targets (miRBase)
| Match Rank: | 6 |
| Score: | 0.55 |
| Offset: | -13 |
| Orientation: | forward strand |
| Alignment: | -------------GACGTACT- AACCCTCTAAAAGGAAGCACTT |
|
|
|
hsa-miR-4757-3p MIMAT0019902 Homo sapiens miR-4757-3p Targets (miRBase)
| Match Rank: | 7 |
| Score: | 0.55 |
| Offset: | -13 |
| Orientation: | forward strand |
| Alignment: | -------------GACGTACT- GCGAAGCCTCTGTGACGTCATG |
|
|
|
hsa-miR-519e MIMAT0002829 Homo sapiens miR-519e Targets (miRBase)
| Match Rank: | 8 |
| Score: | 0.55 |
| Offset: | -13 |
| Orientation: | forward strand |
| Alignment: | -------------GACGTACT- AACACTCTAAAAGGAGGCACTT |
|
|
|
hsa-miR-22* MIMAT0004495 Homo sapiens miR-22* Targets (miRBase)
| Match Rank: | 9 |
| Score: | 0.55 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------GACGTACT TAAAGCTTGCCACTGAAGAACT |
|
|
|
hsa-miR-33b* MIMAT0004811 Homo sapiens miR-33b* Targets (miRBase)
| Match Rank: | 10 |
| Score: | 0.55 |
| Offset: | -13 |
| Orientation: | forward strand |
| Alignment: | -------------GACGTACT- GGGCTGCACTGCCGAGGCACTG |
|
|
|