| p-value: | 1e-28 |
| log p-value: | -6.529e+01 |
| Information Content per bp: | 1.747 |
| Number of Target Sequences with motif | 29.0 |
| Percentage of Target Sequences with motif | 0.20% |
| Number of Background Sequences with motif | 3.3 |
| Percentage of Background Sequences with motif | 0.01% |
| Average Position of motif in Targets | 111.4 +/- 92.5bp |
| Average Position of motif in Background | 118.3 +/- 41.4bp |
| Strand Bias (log2 ratio + to - strand density) | 10.0 |
| Multiplicity (# of sites on avg that occur together) | 1.00 |
| Motif File: | file (matrix) reverse opposite |
| SVG Files for Logos: | forward logo reverse opposite |
hsa-miR-4281 MIMAT0016907 Homo sapiens miR-4281 Targets (miRBase)
| Match Rank: | 1 |
| Score: | 0.67 |
| Offset: | -9 |
| Orientation: | forward strand |
| Alignment: | ---------TCGGGACGCY CCCCCCTCCCCGGGACCC- |
|
|
|
hsa-miR-4454 MIMAT0018976 Homo sapiens miR-4454 Targets (miRBase)
| Match Rank: | 2 |
| Score: | 0.62 |
| Offset: | -12 |
| Orientation: | forward strand |
| Alignment: | ------------TCGGGACGCY TGGTGCCGTGACTCGGATCC-- |
|
|
|
hsa-miR-198 MIMAT0000228 Homo sapiens miR-198 Targets (miRBase)
| Match Rank: | 3 |
| Score: | 0.60 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------TCGGGACGCY GAACCTATCTCCCCTCTGGACC-- |
|
|
|
hsa-miR-4449 MIMAT0018968 Homo sapiens miR-4449 Targets (miRBase)
| Match Rank: | 4 |
| Score: | 0.59 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------TCGGGACGCY TGCCTCGCGCAGCCCCGGGACG-- |
|
|
|
hsa-miR-4634 MIMAT0019691 Homo sapiens miR-4634 Targets (miRBase)
| Match Rank: | 5 |
| Score: | 0.55 |
| Offset: | -11 |
| Orientation: | forward strand |
| Alignment: | -----------TCGGGACGCY CCCCGGGCCGGTCGCGCCG-- |
|
|
|
hsa-miR-4255 MIMAT0016885 Homo sapiens miR-4255 Targets (miRBase)
| Match Rank: | 6 |
| Score: | 0.53 |
| Offset: | -6 |
| Orientation: | forward strand |
| Alignment: | ------TCGGGACGCY- TCCATCTCTGAACACTG |
|
|
|
hsa-miR-126 MIMAT0000445 Homo sapiens miR-126 Targets (miRBase)
| Match Rank: | 7 |
| Score: | 0.53 |
| Offset: | -13 |
| Orientation: | forward strand |
| Alignment: | -------------TCGGGACGCY CGCATTATTACTCACGGTACGA- |
|
|
|
hsa-miR-23a* MIMAT0004496 Homo sapiens miR-23a* Targets (miRBase)
| Match Rank: | 8 |
| Score: | 0.52 |
| Offset: | -12 |
| Orientation: | forward strand |
| Alignment: | ------------TCGGGACGCY AAATCCCATCCCCAGGAACCCC |
|
|
|
hsa-miR-4537 MIMAT0019080 Homo sapiens miR-4537 Targets (miRBase)
| Match Rank: | 9 |
| Score: | 0.51 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------TCGGGACGCY CAGCTAAGCTCAGCTCGGCTCA-- |
|
|
|
hsa-miR-615-5p MIMAT0004804 Homo sapiens miR-615-5p Targets (miRBase)
| Match Rank: | 10 |
| Score: | 0.50 |
| Offset: | -11 |
| Orientation: | forward strand |
| Alignment: | -----------TCGGGACGCY- GATCCGAGCACCGGGGACCCCC |
|
|
|