| p-value: | 1e-27 |
| log p-value: | -6.363e+01 |
| Information Content per bp: | 1.924 |
| Number of Target Sequences with motif | 2989.0 |
| Percentage of Target Sequences with motif | 20.37% |
| Number of Background Sequences with motif | 5792.4 |
| Percentage of Background Sequences with motif | 16.88% |
| Average Position of motif in Targets | 159.0 +/- 152.0bp |
| Average Position of motif in Background | 102.9 +/- 67.7bp |
| Strand Bias (log2 ratio + to - strand density) | 10.0 |
| Multiplicity (# of sites on avg that occur together) | 1.24 |
| Motif File: | file (matrix) reverse opposite |
| SVG Files for Logos: | forward logo reverse opposite |
hsa-miR-4328 MIMAT0016926 Homo sapiens miR-4328 Targets (miRBase)
| Match Rank: | 1 |
| Score: | 0.74 |
| Offset: | -10 |
| Orientation: | forward strand |
| Alignment: | ----------AAACT-- AATCCTGGGAAAACTGG |
|
|
|
hsa-miR-561 MIMAT0003225 Homo sapiens miR-561 Targets (miRBase)
| Match Rank: | 2 |
| Score: | 0.70 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------AAACT--- ACTTCAAGGATCTTAAACTTTG |
|
|
|
hsa-miR-1290 MIMAT0005880 Homo sapiens miR-1290 Targets (miRBase)
| Match Rank: | 3 |
| Score: | 0.66 |
| Offset: | -11 |
| Orientation: | forward strand |
| Alignment: | -----------AAACT--- TCCCTGATCCAAAAATCCA |
|
|
|
hsa-miR-590-3p MIMAT0004801 Homo sapiens miR-590-3p Targets (miRBase)
| Match Rank: | 4 |
| Score: | 0.65 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------AAACT-- ACTAGCTTATACATAAAATTA |
|
|
|
hsa-miR-4775 MIMAT0019931 Homo sapiens miR-4775 Targets (miRBase)
| Match Rank: | 5 |
| Score: | 0.65 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------AAACT--- AGTGACCGAAACAAAAAATTAA |
|
|
|
hsa-miR-223 MIMAT0000280 Homo sapiens miR-223 Targets (miRBase)
| Match Rank: | 6 |
| Score: | 0.61 |
| Offset: | -13 |
| Orientation: | forward strand |
| Alignment: | -------------AAACT---- TGGGGTATTTGACAAACTGACA |
|
|
|
hsa-miR-19a* MIMAT0004490 Homo sapiens miR-19a* Targets (miRBase)
| Match Rank: | 7 |
| Score: | 0.61 |
| Offset: | -17 |
| Orientation: | forward strand |
| Alignment: | -----------------AAACT TGTAGTGCAACTATGCAAAACT |
|
|
|
hsa-miR-19b-2* MIMAT0004492 Homo sapiens miR-19b-2* Targets (miRBase)
| Match Rank: | 8 |
| Score: | 0.61 |
| Offset: | -17 |
| Orientation: | forward strand |
| Alignment: | -----------------AAACT TGAAATGCAAACCTGCAAAACT |
|
|
|
hsa-miR-19b-1* MIMAT0004491 Homo sapiens miR-19b-1* Targets (miRBase)
| Match Rank: | 9 |
| Score: | 0.60 |
| Offset: | -18 |
| Orientation: | forward strand |
| Alignment: | ------------------AAACT GCTGGATGCAAACCTGCAAAACT |
|
|
|
hsa-miR-145 MIMAT0000437 Homo sapiens miR-145 Targets (miRBase)
| Match Rank: | 10 |
| Score: | 0.60 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------AAACT---- AGGGATTCCTGGGAAAACTGGAC |
|
|
|