| p-value: | 1e-25 |
| log p-value: | -5.875e+01 |
| Information Content per bp: | 1.910 |
| Number of Target Sequences with motif | 629.0 |
| Percentage of Target Sequences with motif | 4.29% |
| Number of Background Sequences with motif | 943.2 |
| Percentage of Background Sequences with motif | 2.75% |
| Average Position of motif in Targets | 163.4 +/- 173.3bp |
| Average Position of motif in Background | 102.1 +/- 68.5bp |
| Strand Bias (log2 ratio + to - strand density) | 10.0 |
| Multiplicity (# of sites on avg that occur together) | 1.08 |
| Motif File: | file (matrix) reverse opposite |
| SVG Files for Logos: | forward logo reverse opposite |
hsa-miR-1290 MIMAT0005880 Homo sapiens miR-1290 Targets (miRBase)
| Match Rank: | 1 |
| Score: | 0.80 |
| Offset: | -11 |
| Orientation: | forward strand |
| Alignment: | -----------ACAATCCA TCCCTGATCCAAAAATCCA |
|
|
|
hsa-miR-1246 MIMAT0005898 Homo sapiens miR-1246 Targets (miRBase)
| Match Rank: | 2 |
| Score: | 0.79 |
| Offset: | -9 |
| Orientation: | forward strand |
| Alignment: | ---------ACAATCCA-- CCTGCTCCAAAAATCCATT |
|
|
|
hsa-miR-4320 MIMAT0016871 Homo sapiens miR-4320 Targets (miRBase)
| Match Rank: | 3 |
| Score: | 0.69 |
| Offset: | -10 |
| Orientation: | forward strand |
| Alignment: | ----------ACAATCCA AGGAAGCTACAGAATCCC |
|
|
|
hsa-miR-3673 MIMAT0018096 Homo sapiens miR-3673 Targets (miRBase)
| Match Rank: | 4 |
| Score: | 0.68 |
| Offset: | -12 |
| Orientation: | forward strand |
| Alignment: | ------------ACAATCCA- TATTCCGTATATACATTCCAT |
|
|
|
hsa-miR-33a MIMAT0000091 Homo sapiens miR-33a Targets (miRBase)
| Match Rank: | 5 |
| Score: | 0.68 |
| Offset: | -12 |
| Orientation: | forward strand |
| Alignment: | ------------ACAATCCA- TGCAATGCAACTACAATGCAC |
|
|
|
hsa-miR-122 MIMAT0000421 Homo sapiens miR-122 Targets (miRBase)
| Match Rank: | 6 |
| Score: | 0.67 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------ACAATCCA CAAACACCATTGTCACACTCCA |
|
|
|
hsa-miR-206 MIMAT0000462 Homo sapiens miR-206 Targets (miRBase)
| Match Rank: | 7 |
| Score: | 0.67 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------ACAATCCA CCACACACTTCCTTACATTCCA |
|
|
|
hsa-miR-1 MIMAT0000416 Homo sapiens miR-1 Targets (miRBase)
| Match Rank: | 8 |
| Score: | 0.67 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------ACAATCCA ATACATACTTCTTTACATTCCA |
|
|
|
hsa-miR-219-5p MIMAT0000276 Homo sapiens miR-219-5p Targets (miRBase)
| Match Rank: | 9 |
| Score: | 0.66 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------ACAATCCA AGAATTGCGTTTGGACAATCA- |
|
|
|
hsa-miR-4445 MIMAT0018963 Homo sapiens miR-4445 Targets (miRBase)
| Match Rank: | 10 |
| Score: | 0.66 |
| Offset: | -15 |
| Orientation: | forward strand |
| Alignment: | ---------------ACAATCCA TGCACGGCAAAAGAAACAATCT- |
|
|
|