| p-value: | 1e-24 |
| log p-value: | -5.736e+01 |
| Information Content per bp: | 1.476 |
| Number of Target Sequences with motif | 29.0 |
| Percentage of Target Sequences with motif | 0.20% |
| Number of Background Sequences with motif | 4.1 |
| Percentage of Background Sequences with motif | 0.01% |
| Average Position of motif in Targets | 144.9 +/- 106.9bp |
| Average Position of motif in Background | 94.3 +/- 6.1bp |
| Strand Bias (log2 ratio + to - strand density) | 10.0 |
| Multiplicity (# of sites on avg that occur together) | 1.00 |
| Motif File: | file (matrix) reverse opposite |
| SVG Files for Logos: | forward logo reverse opposite |
hsa-miR-4725-5p MIMAT0019843 Homo sapiens miR-4725-5p Targets (miRBase)
| Match Rank: | 1 |
| Score: | 0.57 |
| Offset: | -13 |
| Orientation: | forward strand |
| Alignment: | -------------CAGGTTCCAATG GGTGGGAAGGCTGCAGGGTCT---- |
|
|
|
hsa-miR-504 MIMAT0002875 Homo sapiens miR-504 Targets (miRBase)
| Match Rank: | 2 |
| Score: | 0.57 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------CAGGTTCCAATG GATAGAGTGCAGACCAGGGTCT---- |
|
|
|
hsa-miR-3649 MIMAT0018069 Homo sapiens miR-3649 Targets (miRBase)
| Match Rank: | 3 |
| Score: | 0.57 |
| Offset: | -10 |
| Orientation: | forward strand |
| Alignment: | ----------CAGGTTCCAATG CTTAGACACTCAGGTCCCT--- |
|
|
|
hsa-miR-4260 MIMAT0016881 Homo sapiens miR-4260 Targets (miRBase)
| Match Rank: | 4 |
| Score: | 0.56 |
| Offset: | -8 |
| Orientation: | forward strand |
| Alignment: | --------CAGGTTCCAATG TGGGACTCCATGCCCCAAG- |
|
|
|
hsa-miR-2861 MIMAT0013802 Homo sapiens miR-2861 Targets (miRBase)
| Match Rank: | 5 |
| Score: | 0.55 |
| Offset: | -11 |
| Orientation: | forward strand |
| Alignment: | -----------CAGGTTCCAATG CCGCCCACCGCCAGGCCCC---- |
|
|
|
hsa-miR-1271 MIMAT0005796 Homo sapiens miR-1271 Targets (miRBase)
| Match Rank: | 6 |
| Score: | 0.54 |
| Offset: | -11 |
| Orientation: | forward strand |
| Alignment: | -----------CAGGTTCCAATG TGAGTGCTTGCTAGGTGCCAAG- |
|
|
|
hsa-miR-492 MIMAT0002812 Homo sapiens miR-492 Targets (miRBase)
| Match Rank: | 7 |
| Score: | 0.54 |
| Offset: | -15 |
| Orientation: | forward strand |
| Alignment: | ---------------CAGGTTCCAATG AAGAATCTTGTCCCGCAGGTCCT---- |
|
|
|
hsa-miR-4738-3p MIMAT0019867 Homo sapiens miR-4738-3p Targets (miRBase)
| Match Rank: | 8 |
| Score: | 0.53 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------CAGGTTCCAATG TCCTCCAGGCGCTCCAGTTTCA---- |
|
|
|
hsa-miR-635 MIMAT0003305 Homo sapiens miR-635 Targets (miRBase)
| Match Rank: | 9 |
| Score: | 0.52 |
| Offset: | -11 |
| Orientation: | forward strand |
| Alignment: | -----------CAGGTTCCAATG GGACATTGTTTCAGTGCCCAAGT |
|
|
|
hsa-miR-4300 MIMAT0016853 Homo sapiens miR-4300 Targets (miRBase)
| Match Rank: | 10 |
| Score: | 0.52 |
| Offset: | -9 |
| Orientation: | forward strand |
| Alignment: | ---------CAGGTTCCAATG GAAGTAGTCCAGCTCCCA--- |
|
|
|