| p-value: | 1e-125 |
| log p-value: | -2.881e+02 |
| Information Content per bp: | 1.776 |
| Number of Target Sequences with motif | 2931.0 |
| Percentage of Target Sequences with motif | 19.97% |
| Number of Background Sequences with motif | 4435.2 |
| Percentage of Background Sequences with motif | 12.93% |
| Average Position of motif in Targets | 158.9 +/- 148.8bp |
| Average Position of motif in Background | 102.5 +/- 66.3bp |
| Strand Bias (log2 ratio + to - strand density) | 10.0 |
| Multiplicity (# of sites on avg that occur together) | 1.17 |
| Motif File: | file (matrix) reverse opposite |
| SVG Files for Logos: | forward logo reverse opposite |
hsa-miR-4432 MIMAT0018948 Homo sapiens miR-4432 Targets (miRBase)
| Match Rank: | 1 |
| Score: | 0.72 |
| Offset: | -11 |
| Orientation: | forward strand |
| Alignment: | -----------AAAGTCTT- AGGCATCTTGCAGAGTCTTT |
|
|
|
hsa-miR-499-5p MIMAT0002870 Homo sapiens miR-499-5p Targets (miRBase)
| Match Rank: | 2 |
| Score: | 0.72 |
| Offset: | -11 |
| Orientation: | forward strand |
| Alignment: | -----------AAAGTCTT-- AAACATCACTGCAAGTCTTAA |
|
|
|
hsa-miR-548u MIMAT0015013 Homo sapiens miR-548u Targets (miRBase)
| Match Rank: | 3 |
| Score: | 0.66 |
| Offset: | -13 |
| Orientation: | forward strand |
| Alignment: | -------------AAAGTCTT-- CGCAAAAGTAATTGCAGTCTTTG |
|
|
|
hsa-miR-499a-5p MIMAT0019897 Homo sapiens miR-499a-5p Targets (miRBase)
| Match Rank: | 4 |
| Score: | 0.65 |
| Offset: | -12 |
| Orientation: | forward strand |
| Alignment: | ------------AAAGTCTT- TGAACATCACAGCAAGTCTGT |
|
|
|
hsa-miR-1264 MIMAT0005791 Homo sapiens miR-1264 Targets (miRBase)
| Match Rank: | 5 |
| Score: | 0.63 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------AAAGTCTT- AACAGGTGCTCAAATAAGACTTG |
|
|
|
hsa-miR-3617 MIMAT0017997 Homo sapiens miR-3617 Targets (miRBase)
| Match Rank: | 6 |
| Score: | 0.62 |
| Offset: | -13 |
| Orientation: | forward strand |
| Alignment: | -------------AAAGTCTT- CCCATCTTGCAACTATGTCTTT |
|
|
|
hsa-miR-641 MIMAT0003311 Homo sapiens miR-641 Targets (miRBase)
| Match Rank: | 7 |
| Score: | 0.61 |
| Offset: | -15 |
| Orientation: | forward strand |
| Alignment: | ---------------AAAGTCTT- GAGGTGACTCTATCCTATGTCTTT |
|
|
|
hsa-miR-4771 MIMAT0019925 Homo sapiens miR-4771 Targets (miRBase)
| Match Rank: | 8 |
| Score: | 0.59 |
| Offset: | -11 |
| Orientation: | forward strand |
| Alignment: | -----------AAAGTCTT-- TAATTGTAGGTCAAGTCTGCT |
|
|
|
hsa-miR-548g MIMAT0005912 Homo sapiens miR-548g Targets (miRBase)
| Match Rank: | 9 |
| Score: | 0.59 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------AAAGTCTT GTACAAAAGTAATTACAGTTTT |
|
|
|
hsa-miR-4499 MIMAT0019035 Homo sapiens miR-4499 Targets (miRBase)
| Match Rank: | 10 |
| Score: | 0.59 |
| Offset: | -9 |
| Orientation: | forward strand |
| Alignment: | ---------AAAGTCTT TCCCTCCTCTCAGTCTT |
|
|
|