| p-value: | 1e-23 |
| log p-value: | -5.508e+01 |
| Information Content per bp: | 1.653 |
| Number of Target Sequences with motif | 799.0 |
| Percentage of Target Sequences with motif | 5.44% |
| Number of Background Sequences with motif | 1285.0 |
| Percentage of Background Sequences with motif | 3.74% |
| Average Position of motif in Targets | 153.3 +/- 144.9bp |
| Average Position of motif in Background | 102.1 +/- 62.5bp |
| Strand Bias (log2 ratio + to - strand density) | 10.0 |
| Multiplicity (# of sites on avg that occur together) | 1.05 |
| Motif File: | file (matrix) reverse opposite |
| SVG Files for Logos: | forward logo reverse opposite |
hsa-miR-518e MIMAT0002861 Homo sapiens miR-518e Targets (miRBase)
| Match Rank: | 1 |
| Score: | 0.66 |
| Offset: | -12 |
| Orientation: | forward strand |
| Alignment: | ------------GARCGCYT- CACTCTGAAGGGAAGCGCTTT |
|
|
|
hsa-miR-1245b-5p MIMAT0019950 Homo sapiens miR-1245b-5p Targets (miRBase)
| Match Rank: | 2 |
| Score: | 0.63 |
| Offset: | -12 |
| Orientation: | forward strand |
| Alignment: | ------------GARCGCYT- TTTAAGTGATCTAAAGGCCTA |
|
|
|
hsa-miR-518b MIMAT0002844 Homo sapiens miR-518b Targets (miRBase)
| Match Rank: | 3 |
| Score: | 0.63 |
| Offset: | -12 |
| Orientation: | forward strand |
| Alignment: | ------------GARCGCYT-- ACCTCTAAAGGGGAGCGCTTTG |
|
|
|
hsa-miR-3142 MIMAT0015011 Homo sapiens miR-3142 Targets (miRBase)
| Match Rank: | 4 |
| Score: | 0.62 |
| Offset: | -13 |
| Orientation: | forward strand |
| Alignment: | -------------GARCGCYT- TCTGAAGGTTCAGAAAGGCCTT |
|
|
|
hsa-miR-524-3p MIMAT0002850 Homo sapiens miR-524-3p Targets (miRBase)
| Match Rank: | 5 |
| Score: | 0.59 |
| Offset: | -11 |
| Orientation: | forward strand |
| Alignment: | -----------GARCGCYT-- ACTCCAAAGGGAAGCGCCTTC |
|
|
|
hsa-miR-451 MIMAT0001631 Homo sapiens miR-451 Targets (miRBase)
| Match Rank: | 6 |
| Score: | 0.59 |
| Offset: | -13 |
| Orientation: | forward strand |
| Alignment: | -------------GARCGCYT- AACTCAGTAATGGTAACGGTTT |
|
|
|
hsa-miR-4297 MIMAT0016846 Homo sapiens miR-4297 Targets (miRBase)
| Match Rank: | 7 |
| Score: | 0.59 |
| Offset: | -9 |
| Orientation: | forward strand |
| Alignment: | ---------GARCGCYT CACAGACAGGAAGGCA- |
|
|
|
hsa-miR-525-3p MIMAT0002839 Homo sapiens miR-525-3p Targets (miRBase)
| Match Rank: | 8 |
| Score: | 0.59 |
| Offset: | -12 |
| Orientation: | forward strand |
| Alignment: | ------------GARCGCYT-- CGCTCTAAAGGGAAGCGCCTTC |
|
|
|
hsa-miR-3614-3p MIMAT0017993 Homo sapiens miR-3614-3p Targets (miRBase)
| Match Rank: | 9 |
| Score: | 0.58 |
| Offset: | -15 |
| Orientation: | forward strand |
| Alignment: | ---------------GARCGCYT AAAACACCAAGATCTGAAGGCTA |
|
|
|
hsa-miR-1179 MIMAT0005824 Homo sapiens miR-1179 Targets (miRBase)
| Match Rank: | 10 |
| Score: | 0.57 |
| Offset: | -13 |
| Orientation: | forward strand |
| Alignment: | -------------GARCGCYT CCAACCAATGAAAGAATGCTT |
|
|
|