| p-value: | 1e-19 |
| log p-value: | -4.519e+01 |
| Information Content per bp: | 1.599 |
| Number of Target Sequences with motif | 1131.0 |
| Percentage of Target Sequences with motif | 7.71% |
| Number of Background Sequences with motif | 2006.0 |
| Percentage of Background Sequences with motif | 5.85% |
| Average Position of motif in Targets | 161.7 +/- 142.8bp |
| Average Position of motif in Background | 102.7 +/- 60.7bp |
| Strand Bias (log2 ratio + to - strand density) | 10.0 |
| Multiplicity (# of sites on avg that occur together) | 1.13 |
| Motif File: | file (matrix) reverse opposite |
| SVG Files for Logos: | forward logo reverse opposite |
hsa-miR-4283 MIMAT0016914 Homo sapiens miR-4283 Targets (miRBase)
| Match Rank: | 1 |
| Score: | 0.70 |
| Offset: | -9 |
| Orientation: | forward strand |
| Alignment: | ---------DAGSCCCC AAACTCGCTGAGCCCCA |
|
|
|
hsa-miR-2861 MIMAT0013802 Homo sapiens miR-2861 Targets (miRBase)
| Match Rank: | 2 |
| Score: | 0.70 |
| Offset: | -11 |
| Orientation: | forward strand |
| Alignment: | -----------DAGSCCCC CCGCCCACCGCCAGGCCCC |
|
|
|
hsa-miR-4652-5p MIMAT0019716 Homo sapiens miR-4652-5p Targets (miRBase)
| Match Rank: | 3 |
| Score: | 0.69 |
| Offset: | -13 |
| Orientation: | forward strand |
| Alignment: | -------------DAGSCCCC- TAGTTCTATTAACCAGTCCCCT |
|
|
|
hsa-miR-4512 MIMAT0019049 Homo sapiens miR-4512 Targets (miRBase)
| Match Rank: | 4 |
| Score: | 0.66 |
| Offset: | -13 |
| Orientation: | forward strand |
| Alignment: | -------------DAGSCCCC- TGGGCGATACAGTGAGGCCCTG |
|
|
|
hsa-miR-4489 MIMAT0019023 Homo sapiens miR-4489 Targets (miRBase)
| Match Rank: | 5 |
| Score: | 0.65 |
| Offset: | -13 |
| Orientation: | forward strand |
| Alignment: | -------------DAGSCCCC CGTCCTGCATCACTAGCCCCA |
|
|
|
hsa-miR-185* MIMAT0004611 Homo sapiens miR-185* Targets (miRBase)
| Match Rank: | 6 |
| Score: | 0.64 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------DAGSCCCC GACCAGAGGAAAGCCAGCCCCT |
|
|
|
hsa-miR-566 MIMAT0003230 Homo sapiens miR-566 Targets (miRBase)
| Match Rank: | 7 |
| Score: | 0.64 |
| Offset: | -10 |
| Orientation: | forward strand |
| Alignment: | ----------DAGSCCCC- GTTGGGATCACAGGCGCCC |
|
|
|
hsa-miR-4447 MIMAT0018966 Homo sapiens miR-4447 Targets (miRBase)
| Match Rank: | 8 |
| Score: | 0.64 |
| Offset: | -6 |
| Orientation: | forward strand |
| Alignment: | ------DAGSCCCC--- AAACAACAGCCCCCACC |
|
|
|
hsa-miR-4508 MIMAT0019045 Homo sapiens miR-4508 Targets (miRBase)
| Match Rank: | 9 |
| Score: | 0.64 |
| Offset: | -8 |
| Orientation: | forward strand |
| Alignment: | --------DAGSCCCC- CGCGCGCCCAGCCCCGC |
|
|
|
hsa-miR-3144-5p MIMAT0015014 Homo sapiens miR-3144-5p Targets (miRBase)
| Match Rank: | 10 |
| Score: | 0.64 |
| Offset: | -13 |
| Orientation: | forward strand |
| Alignment: | -------------DAGSCCCC- CTATATATCTCTTTGGTCCCCT |
|
|
|