| p-value: | 1e-103 |
| log p-value: | -2.383e+02 |
| Information Content per bp: | 1.666 |
| Number of Target Sequences with motif | 3709.0 |
| Percentage of Target Sequences with motif | 25.27% |
| Number of Background Sequences with motif | 6203.2 |
| Percentage of Background Sequences with motif | 18.08% |
| Average Position of motif in Targets | 147.7 +/- 140.7bp |
| Average Position of motif in Background | 103.5 +/- 66.8bp |
| Strand Bias (log2 ratio + to - strand density) | 10.0 |
| Multiplicity (# of sites on avg that occur together) | 1.16 |
| Motif File: | file (matrix) reverse opposite |
| SVG Files for Logos: | forward logo reverse opposite |
hsa-miR-4800-3p MIMAT0019979 Homo sapiens miR-4800-3p Targets (miRBase)
| Match Rank: | 1 |
| Score: | 0.68 |
| Offset: | -12 |
| Orientation: | forward strand |
| Alignment: | ------------RCGGAC- GTGGACAGACGGACGGATG |
|
|
|
hsa-miR-572 MIMAT0003237 Homo sapiens miR-572 Targets (miRBase)
| Match Rank: | 2 |
| Score: | 0.65 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------RCGGAC TGGGCCACCGCCGAGCGGAC |
|
|
|
hsa-miR-3713 MIMAT0018164 Homo sapiens miR-3713 Targets (miRBase)
| Match Rank: | 3 |
| Score: | 0.64 |
| Offset: | -11 |
| Orientation: | forward strand |
| Alignment: | -----------RCGGAC--- ACCATCCCCAAACGGATACC |
|
|
|
hsa-miR-1468 MIMAT0006789 Homo sapiens miR-1468 Targets (miRBase)
| Match Rank: | 4 |
| Score: | 0.64 |
| Offset: | -15 |
| Orientation: | forward strand |
| Alignment: | ---------------RCGGAC CAGCGAAACAGGCAAACGGAG |
|
|
|
hsa-miR-4669 MIMAT0019749 Homo sapiens miR-4669 Targets (miRBase)
| Match Rank: | 5 |
| Score: | 0.63 |
| Offset: | -13 |
| Orientation: | forward strand |
| Alignment: | -------------RCGGAC--- CCTCCTCCACTTCCCGGACACA |
|
|
|
hsa-miR-937 MIMAT0004980 Homo sapiens miR-937 Targets (miRBase)
| Match Rank: | 6 |
| Score: | 0.62 |
| Offset: | -16 |
| Orientation: | forward strand |
| Alignment: | ----------------RCGGAC GGCAGAGAGTCAGAGCGCGGAT |
|
|
|
hsa-miR-4454 MIMAT0018976 Homo sapiens miR-4454 Targets (miRBase)
| Match Rank: | 7 |
| Score: | 0.61 |
| Offset: | -12 |
| Orientation: | forward strand |
| Alignment: | ------------RCGGAC-- TGGTGCCGTGACTCGGATCC |
|
|
|
hsa-miR-3605-3p MIMAT0017982 Homo sapiens miR-3605-3p Targets (miRBase)
| Match Rank: | 8 |
| Score: | 0.61 |
| Offset: | -16 |
| Orientation: | forward strand |
| Alignment: | ----------------RCGGAC- CTAGAGGACAGGTAACACGGAGG |
|
|
|
hsa-miR-500b MIMAT0016925 Homo sapiens miR-500b Targets (miRBase)
| Match Rank: | 9 |
| Score: | 0.59 |
| Offset: | -11 |
| Orientation: | forward strand |
| Alignment: | -----------RCGGAC- ACCCAGGTAGCAAGGATT |
|
|
|
hsa-miR-2355-3p MIMAT0017950 Homo sapiens miR-2355-3p Targets (miRBase)
| Match Rank: | 10 |
| Score: | 0.58 |
| Offset: | -13 |
| Orientation: | forward strand |
| Alignment: | -------------RCGGAC--- ATCTCCAAACAGCAAGGACAAT |
|
|
|