| p-value: | 1e-16 |
| log p-value: | -3.697e+01 |
| Information Content per bp: | 1.530 |
| Number of Target Sequences with motif | 17.0 |
| Percentage of Target Sequences with motif | 0.12% |
| Number of Background Sequences with motif | 2.4 |
| Percentage of Background Sequences with motif | 0.01% |
| Average Position of motif in Targets | 86.5 +/- 68.2bp |
| Average Position of motif in Background | 92.9 +/- 54.7bp |
| Strand Bias (log2 ratio + to - strand density) | 10.0 |
| Multiplicity (# of sites on avg that occur together) | 1.00 |
| Motif File: | file (matrix) reverse opposite |
| SVG Files for Logos: | forward logo reverse opposite |
hsa-miR-138 MIMAT0000430 Homo sapiens miR-138 Targets (miRBase)
| Match Rank: | 1 |
| Score: | 0.65 |
| Offset: | -13 |
| Orientation: | forward strand |
| Alignment: | -------------AACACCAACA CGGCCTGATTCACAACACCAGCT |
|
|
|
hsa-miR-4781-3p MIMAT0019943 Homo sapiens miR-4781-3p Targets (miRBase)
| Match Rank: | 2 |
| Score: | 0.62 |
| Offset: | -10 |
| Orientation: | forward strand |
| Alignment: | ----------AACACCAACA-- CTCTAGCGAGGATTCCAACATT |
|
|
|
hsa-miR-4694-5p MIMAT0019786 Homo sapiens miR-4694-5p Targets (miRBase)
| Match Rank: | 3 |
| Score: | 0.60 |
| Offset: | -15 |
| Orientation: | forward strand |
| Alignment: | ---------------AACACCAACA GCAAATGGATAGGATAACACCT--- |
|
|
|
hsa-miR-609 MIMAT0003277 Homo sapiens miR-609 Targets (miRBase)
| Match Rank: | 4 |
| Score: | 0.58 |
| Offset: | -12 |
| Orientation: | forward strand |
| Alignment: | ------------AACACCAACA AGAGATGAGAGAAACACCCT-- |
|
|
|
hsa-miR-4425 MIMAT0018940 Homo sapiens miR-4425 Targets (miRBase)
| Match Rank: | 5 |
| Score: | 0.57 |
| Offset: | -12 |
| Orientation: | forward strand |
| Alignment: | ------------AACACCAACA ATGGTCCTGCTGAATCCCAACA |
|
|
|
hsa-miR-3170 MIMAT0015045 Homo sapiens miR-3170 Targets (miRBase)
| Match Rank: | 6 |
| Score: | 0.57 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------AACACCAACA ACTGTCTGTCTCAGAACCCCAG-- |
|
|
|
hsa-miR-3591-5p MIMAT0019876 Homo sapiens miR-3591-5p Targets (miRBase)
| Match Rank: | 7 |
| Score: | 0.55 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------AACACCAACA TCAAACGCCATTATCACACTAAA- |
|
|
|
hsa-miR-1267 MIMAT0005921 Homo sapiens miR-1267 Targets (miRBase)
| Match Rank: | 8 |
| Score: | 0.54 |
| Offset: | -9 |
| Orientation: | forward strand |
| Alignment: | ---------AACACCAACA-- TGGGGATTACACTTCAACAGG |
|
|
|
hsa-miR-367* MIMAT0004686 Homo sapiens miR-367* Targets (miRBase)
| Match Rank: | 9 |
| Score: | 0.54 |
| Offset: | -10 |
| Orientation: | forward strand |
| Alignment: | ----------AACACCAACA-- AGAGTTGCATATTAGCAACAGT |
|
|
|
hsa-miR-876-3p MIMAT0004925 Homo sapiens miR-876-3p Targets (miRBase)
| Match Rank: | 10 |
| Score: | 0.52 |
| Offset: | -15 |
| Orientation: | forward strand |
| Alignment: | ---------------AACACCAACA TGAATTACTTTGTAAACCACCA--- |
|
|
|