| p-value: | 1e-10 |
| log p-value: | -2.399e+01 |
| Information Content per bp: | 1.844 |
| Number of Target Sequences with motif | 10.0 |
| Percentage of Target Sequences with motif | 0.07% |
| Number of Background Sequences with motif | 1.7 |
| Percentage of Background Sequences with motif | 0.01% |
| Average Position of motif in Targets | 132.6 +/- 108.7bp |
| Average Position of motif in Background | 66.3 +/- 23.5bp |
| Strand Bias (log2 ratio + to - strand density) | 10.0 |
| Multiplicity (# of sites on avg that occur together) | 2.70 |
| Motif File: | file (matrix) reverse opposite |
| SVG Files for Logos: | forward logo reverse opposite |
hsa-miR-3663-3p MIMAT0018085 Homo sapiens miR-3663-3p Targets (miRBase)
| Match Rank: | 1 |
| Score: | 0.60 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------TGCTACTCACAA GCGCCCGGCCTGTGTGGTGCTCA--- |
|
|
|
hsa-miR-4677-3p MIMAT0019761 Homo sapiens miR-4677-3p Targets (miRBase)
| Match Rank: | 2 |
| Score: | 0.60 |
| Offset: | -9 |
| Orientation: | forward strand |
| Alignment: | ---------TGCTACTCACAA- AGTAGTTCTTTGGTCTCACAGA |
|
|
|
hsa-miR-3921 MIMAT0018196 Homo sapiens miR-3921 Targets (miRBase)
| Match Rank: | 3 |
| Score: | 0.59 |
| Offset: | -10 |
| Orientation: | forward strand |
| Alignment: | ----------TGCTACTCACAA- ACAAGGCATATGGTACTCAGAGA |
|
|
|
hsa-miR-497 MIMAT0002820 Homo sapiens miR-497 Targets (miRBase)
| Match Rank: | 4 |
| Score: | 0.58 |
| Offset: | -13 |
| Orientation: | forward strand |
| Alignment: | -------------TGCTACTCACAA ACAAACCACAGTGTGCTGCTG---- |
|
|
|
hsa-miR-1911 MIMAT0007885 Homo sapiens miR-1911 Targets (miRBase)
| Match Rank: | 5 |
| Score: | 0.58 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------TGCTACTCACAA CCCAACAGACATGGCGGTACTCA--- |
|
|
|
hsa-miR-424 MIMAT0001341 Homo sapiens miR-424 Targets (miRBase)
| Match Rank: | 6 |
| Score: | 0.58 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------TGCTACTCACAA TTCAAAACATGAATTGCTGCTG---- |
|
|
|
hsa-miR-195 MIMAT0000461 Homo sapiens miR-195 Targets (miRBase)
| Match Rank: | 7 |
| Score: | 0.58 |
| Offset: | -13 |
| Orientation: | forward strand |
| Alignment: | -------------TGCTACTCACAA GCCAATATTTCTGTGCTGCTA---- |
|
|
|
hsa-miR-15b MIMAT0000417 Homo sapiens miR-15b Targets (miRBase)
| Match Rank: | 8 |
| Score: | 0.57 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------TGCTACTCACAA TGTAAACCATGATGTGCTGCTA---- |
|
|
|
hsa-miR-16 MIMAT0000069 Homo sapiens miR-16 Targets (miRBase)
| Match Rank: | 9 |
| Score: | 0.57 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------TGCTACTCACAA CGCCAATATTTACGTGCTGCTA---- |
|
|
|
hsa-miR-15a MIMAT0000068 Homo sapiens miR-15a Targets (miRBase)
| Match Rank: | 10 |
| Score: | 0.57 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------TGCTACTCACAA CACAAACCATTATGTGCTGCTA---- |
|
|
|