| p-value: | 1e-92 |
| log p-value: | -2.127e+02 |
| Information Content per bp: | 1.843 |
| Number of Target Sequences with motif | 2849.0 |
| Percentage of Target Sequences with motif | 19.41% |
| Number of Background Sequences with motif | 4580.9 |
| Percentage of Background Sequences with motif | 13.35% |
| Average Position of motif in Targets | 165.5 +/- 159.0bp |
| Average Position of motif in Background | 104.6 +/- 66.6bp |
| Strand Bias (log2 ratio + to - strand density) | 10.0 |
| Multiplicity (# of sites on avg that occur together) | 1.17 |
| Motif File: | file (matrix) reverse opposite |
| SVG Files for Logos: | forward logo reverse opposite |
hsa-miR-181a* MIMAT0000270 Homo sapiens miR-181a* Targets (miRBase)
| Match Rank: | 1 |
| Score: | 0.78 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------TCGATG-- GGTACAATCAACGGTCGATGGT |
|
|
|
hsa-miR-181c* MIMAT0004559 Homo sapiens miR-181c* Targets (miRBase)
| Match Rank: | 2 |
| Score: | 0.70 |
| Offset: | -13 |
| Orientation: | forward strand |
| Alignment: | -------------TCGATG--- GTCCACTCAACGGTCGATGGTT |
|
|
|
hsa-miR-136* MIMAT0004606 Homo sapiens miR-136* Targets (miRBase)
| Match Rank: | 3 |
| Score: | 0.64 |
| Offset: | -13 |
| Orientation: | forward strand |
| Alignment: | -------------TCGATG--- AGACTCATTTGAGACGATGATG |
|
|
|
hsa-miR-490-5p MIMAT0004764 Homo sapiens miR-490-5p Targets (miRBase)
| Match Rank: | 4 |
| Score: | 0.63 |
| Offset: | -13 |
| Orientation: | forward strand |
| Alignment: | -------------TCGATG- ACCCACCTGGAGATCCATGG |
|
|
|
hsa-miR-376c MIMAT0000720 Homo sapiens miR-376c Targets (miRBase)
| Match Rank: | 5 |
| Score: | 0.63 |
| Offset: | -13 |
| Orientation: | forward strand |
| Alignment: | -------------TCGATG-- ACGTGGAATTTCCTCTATGTT |
|
|
|
hsa-miR-376a MIMAT0000729 Homo sapiens miR-376a Targets (miRBase)
| Match Rank: | 6 |
| Score: | 0.63 |
| Offset: | -13 |
| Orientation: | forward strand |
| Alignment: | -------------TCGATG-- ACGTGGATTTTCCTCTATGAT |
|
|
|
hsa-miR-376b MIMAT0002172 Homo sapiens miR-376b Targets (miRBase)
| Match Rank: | 7 |
| Score: | 0.62 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------TCGATG-- AACATGGATTTTCCTCTATGAT |
|
|
|
hsa-miR-4802-3p MIMAT0019982 Homo sapiens miR-4802-3p Targets (miRBase)
| Match Rank: | 8 |
| Score: | 0.62 |
| Offset: | -15 |
| Orientation: | forward strand |
| Alignment: | ---------------TCGATG-- GCTTGAAGGTTTCCATCCATGTA |
|
|
|
hsa-miR-3913-3p MIMAT0019225 Homo sapiens miR-3913-3p Targets (miRBase)
| Match Rank: | 9 |
| Score: | 0.60 |
| Offset: | -13 |
| Orientation: | forward strand |
| Alignment: | -------------TCGATG--- TTTGGGACTGATCTTGATGTCT |
|
|
|
hsa-miR-1256 MIMAT0005907 Homo sapiens miR-1256 Targets (miRBase)
| Match Rank: | 10 |
| Score: | 0.59 |
| Offset: | -13 |
| Orientation: | forward strand |
| Alignment: | -------------TCGATG--- AGCTAGTGAGAAGTCAATGCCT |
|
|
|