| p-value: | 1e-80 |
| log p-value: | -1.853e+02 |
| Information Content per bp: | 1.527 |
| Number of Target Sequences with motif | 5383.0 |
| Percentage of Target Sequences with motif | 36.68% |
| Number of Background Sequences with motif | 10074.7 |
| Percentage of Background Sequences with motif | 29.36% |
| Average Position of motif in Targets | 158.3 +/- 150.1bp |
| Average Position of motif in Background | 102.9 +/- 68.3bp |
| Strand Bias (log2 ratio + to - strand density) | 10.0 |
| Multiplicity (# of sites on avg that occur together) | 1.45 |
| Motif File: | file (matrix) reverse opposite |
| SVG Files for Logos: | forward logo reverse opposite |
hsa-miR-591 MIMAT0003259 Homo sapiens miR-591 Targets (miRBase)
| Match Rank: | 1 |
| Score: | 0.67 |
| Offset: | -13 |
| Orientation: | forward strand |
| Alignment: | -------------ATCGTC- ACAATGAGAACCCATGGTCT |
|
|
|
hsa-miR-3619-3p MIMAT0019219 Homo sapiens miR-3619-3p Targets (miRBase)
| Match Rank: | 2 |
| Score: | 0.65 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------ATCGTC-- CCACAGCAGGCAGGATGGTCCC |
|
|
|
hsa-miR-3682-3p MIMAT0018110 Homo sapiens miR-3682-3p Targets (miRBase)
| Match Rank: | 3 |
| Score: | 0.64 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------ATCGTC- CTACCTCCACCTGTATCATCA |
|
|
|
hsa-miR-4699-5p MIMAT0019794 Homo sapiens miR-4699-5p Targets (miRBase)
| Match Rank: | 4 |
| Score: | 0.62 |
| Offset: | -15 |
| Orientation: | forward strand |
| Alignment: | ---------------ATCGTC- GGAACTTACTCTGCAATCTTCT |
|
|
|
hsa-miR-1185 MIMAT0005798 Homo sapiens miR-1185 Targets (miRBase)
| Match Rank: | 5 |
| Score: | 0.60 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------ATCGTC- AACATACAAAGGGTATCCTCT |
|
|
|
hsa-miR-625* MIMAT0004808 Homo sapiens miR-625* Targets (miRBase)
| Match Rank: | 6 |
| Score: | 0.59 |
| Offset: | -16 |
| Orientation: | forward strand |
| Alignment: | ----------------ATCGTC TGAGGGGGAAAGTTCTATAGTC |
|
|
|
hsa-miR-3605-5p MIMAT0017981 Homo sapiens miR-3605-5p Targets (miRBase)
| Match Rank: | 7 |
| Score: | 0.59 |
| Offset: | -16 |
| Orientation: | forward strand |
| Alignment: | ----------------ATCGTC- GGCTTCCTTGCTATCCATCCTCA |
|
|
|
hsa-miR-3679-5p MIMAT0018104 Homo sapiens miR-3679-5p Targets (miRBase)
| Match Rank: | 8 |
| Score: | 0.59 |
| Offset: | -16 |
| Orientation: | forward strand |
| Alignment: | ----------------ATCGTC- TCCCCTTCCCTGCCATATCCTCA |
|
|
|
hsa-miR-4504 MIMAT0019040 Homo sapiens miR-4504 Targets (miRBase)
| Match Rank: | 9 |
| Score: | 0.56 |
| Offset: | -13 |
| Orientation: | forward strand |
| Alignment: | -------------ATCGTC--- CATGTTCATCTCTATTGTCACA |
|
|
|
hsa-miR-4426 MIMAT0018941 Homo sapiens miR-4426 Targets (miRBase)
| Match Rank: | 10 |
| Score: | 0.55 |
| Offset: | -11 |
| Orientation: | forward strand |
| Alignment: | -----------ATCGTC AAAGTACGTCCATCTTC |
|
|
|