| p-value: | 1e-59 |
| log p-value: | -1.378e+02 |
| Information Content per bp: | 1.877 |
| Number of Target Sequences with motif | 1102.0 |
| Percentage of Target Sequences with motif | 7.51% |
| Number of Background Sequences with motif | 1529.4 |
| Percentage of Background Sequences with motif | 4.46% |
| Average Position of motif in Targets | 144.3 +/- 134.6bp |
| Average Position of motif in Background | 102.1 +/- 67.1bp |
| Strand Bias (log2 ratio + to - strand density) | 10.0 |
| Multiplicity (# of sites on avg that occur together) | 1.07 |
| Motif File: | file (matrix) reverse opposite |
| SVG Files for Logos: | forward logo reverse opposite |
hsa-miR-943 MIMAT0004986 Homo sapiens miR-943 Targets (miRBase)
| Match Rank: | 1 |
| Score: | 0.78 |
| Offset: | -13 |
| Orientation: | forward strand |
| Alignment: | -------------ACAGTCAC CTGGAGGACGGCAACAGTCAG |
|
|
|
hsa-miR-134 MIMAT0000447 Homo sapiens miR-134 Targets (miRBase)
| Match Rank: | 2 |
| Score: | 0.75 |
| Offset: | -13 |
| Orientation: | forward strand |
| Alignment: | -------------ACAGTCAC- CCCCTCTGGTCAACCAGTCACA |
|
|
|
hsa-miR-3118 MIMAT0014980 Homo sapiens miR-3118 Targets (miRBase)
| Match Rank: | 3 |
| Score: | 0.75 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------ACAGTCAC- AGAATTTTCATAATGCAGTCACA |
|
|
|
hsa-miR-3199 MIMAT0015084 Homo sapiens miR-3199 Targets (miRBase)
| Match Rank: | 4 |
| Score: | 0.68 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------ACAGTCAC- AACTTTCTCCTAAGGCAGTCCCT |
|
|
|
hsa-miR-3164 MIMAT0015038 Homo sapiens miR-3164 Targets (miRBase)
| Match Rank: | 5 |
| Score: | 0.67 |
| Offset: | -13 |
| Orientation: | forward strand |
| Alignment: | -------------ACAGTCAC- CGCCATTTCCCTTAAAGTCACA |
|
|
|
hsa-miR-4439 MIMAT0018957 Homo sapiens miR-4439 Targets (miRBase)
| Match Rank: | 6 |
| Score: | 0.66 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------ACAGTCAC ATGCCTCCAAGGTATCAGTCAC |
|
|
|
hsa-miR-4658 MIMAT0019725 Homo sapiens miR-4658 Targets (miRBase)
| Match Rank: | 7 |
| Score: | 0.66 |
| Offset: | -15 |
| Orientation: | forward strand |
| Alignment: | ---------------ACAGTCAC ATTCCTCCAGGATCCACACTCAC |
|
|
|
hsa-miR-4318 MIMAT0016869 Homo sapiens miR-4318 Targets (miRBase)
| Match Rank: | 8 |
| Score: | 0.63 |
| Offset: | -11 |
| Orientation: | forward strand |
| Alignment: | -----------ACAGTCAC AGCATGTACCCACAGTG-- |
|
|
|
hsa-miR-4652-5p MIMAT0019716 Homo sapiens miR-4652-5p Targets (miRBase)
| Match Rank: | 9 |
| Score: | 0.62 |
| Offset: | -12 |
| Orientation: | forward strand |
| Alignment: | ------------ACAGTCAC-- TAGTTCTATTAACCAGTCCCCT |
|
|
|
hsa-miR-452 MIMAT0001635 Homo sapiens miR-452 Targets (miRBase)
| Match Rank: | 10 |
| Score: | 0.62 |
| Offset: | -16 |
| Orientation: | forward strand |
| Alignment: | ----------------ACAGTCAC TCAGTTTCCTCTGCAAACAGTT-- |
|
|
|